SimpleSearch - Line and FST details


Line specific information

 
Line ID 655B10
Vector Used pAC161
Line Availability only available from NASC (N462806)
Segregation Analysis 50:48:36
Confirmed for Hit At3g07880
Parent of DUPLO pair none
Parent of pair(s) 128, 8107

Gene hit At3g07880

 
Sequence (A. th genome BLAST matches underlined)
>74-K025927-022-655-B10-8409
TCTTGACGCTGCCAAAGCAAAATCCCTAAATTTGCCCTCATTTCCCTCTGATTAGATCCC
TTACCCCGACAAAGACACCAAAATTCTTGAGGGCGAGAGAGCTGATTGATGTCTTTGGTA
TCTGGAGCCAGGGACATGGGGTTCGACGACAACAACAACAACAAGAACAACAAGGATGGA
GATGATGAGAACTCCTCCTCCAGAACAAGAGCCGACGACGATGCTCTTAGTCGACAGATG
AGCGAATCTTCTCTTTGTGCTACCGAGGAGGAAGAAGACGACGATTCCAAATTGCAATTG
GGTCCTCAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR398116 [GenBank]
Graphic View Graphic view of gene At3g07880
Predicted Position of Insertion Chr3:2514084 - go to primer design
BLAST e Value 9e-121
Hit Clone Code (BAC ID) F17A17
Hit Gene Code At3g07880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Immunoglobulin E-set superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR398115 [GenBank] CR398116 [GenBank]


Last Updated on 31.08.2016 09:40