SimpleSearch - Line and FST details


Line specific information

 
Line ID 655C10
Vector Used pAC161
Line Availability available as T3 set from NASC (N462818)
Segregation Analysis 50:47:43
Confirmed for Hit At3g45150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g45150

 
Sequence (A. th genome BLAST matches underlined) 
>75-K022840-022-655-C10-8409
GATGGCGAAACTGGCAAGTGACTCCTCCAGAATGCCAAGTCTGCTATTTTCGCAGCCGCG
GGACATGGTGTCACCACCACCTCCAATGAAGATATCCAGCCAAATAGGAATTTTCCTATG
GGATCCTCCCTATACTGAGTC
GenBank Accession BX660522 [GenBank]
Graphic View Graphic view of gene At3g45150
Predicted Position of Insertion Chr3:16531302 - go to primer design
BLAST e Value 6e-39
Hit Clone Code (BAC ID) T14D3
Hit Gene Code At3g45150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TCP domain protein 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR398132 [GenBank] BX660522 [GenBank]


Last Updated on 10.06.2021 13:37