SimpleSearch - Line and FST details


Line specific information

 
Line ID 655C10
Vector Used pAC161
Line Availability only available from NASC (N462818)
Segregation Analysis 50:47:43
Confirmed for Hit At3g45150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g45150

 
Sequence (A. th genome BLAST matches underlined)
>75-K025926-022-655-C10-8409
GAAACTGGCAGATTGGCTCCTCCAGAATGCCGAGCCTGCCATTTTCGCAGCCACGGGACA
TGGTGTCACCACCACCTCCAATGAAGATATCCAGCCAAATAGGAATTTTCCTAGTTACAC
CTTTAATGGTGATAATATTAGTAATAACGTTTTCCCTTGTATGGCATCCTCCCTATAGTG
AGACCATATCGCTAGTATTTGAACGCAGGTATGGGATCCTCCCTATAATGAGAAGACTGC
TGTCCCATATTATTAAGACTACATTGAGAACCTGCAAACTTATGAGTATGCAGAGGCATA
GGTACACCAAAATGGTTTTTTCTATAATTAATGTTGAGGGGGGGGGGGAATCTCGATTCA
TTTCANGCTCCCNCAGGAGTTCTTTTAAAGGTGCAATTGGCATCAGAAACTGGGAGTTTG
TCTACCCCCCTATTTGTAGTATCCTCTTGAACAT
GenBank Accession CR398131 [GenBank]
Graphic View Graphic view of gene At3g45150
Predicted Position of Insertion Chr3:16531291 - go to primer design
BLAST e Value 6e-79
Hit Clone Code (BAC ID) T14D3
Hit Gene Code At3g45150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TCP domain protein 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03