SimpleSearch - Line and FST details


Line specific information

 
Line ID 655D01
Vector Used pAC161
Line Availability only available from NASC (N462821)
Segregation Analysis 50:50:34
Confirmed for Hit At1g02910 At2g40140
Parent of DUPLO pair 7910
Parent of pair(s) none

Gene hit At1g02910

 
Sequence (A. th genome BLAST matches underlined)
>04-K025926-022-655-D01-8409
CCATTTTGATGGTTAACTTTCTGGTTCAACCTTGTACTGCGTGGTATGCGAATGATTGTA
CGGATTGCCCATTAGTGCATCCCGCGTGACAATGCAATGAATTCAAACATGCTAAAGAAG
TAACCGTACACCTGGGTGCCTTGTCCCGAGATTCGTACAGAGTCTTGCCCCAAAGAAGAT
TCGTGCGCTTATTTCCTGCGCCATGGGGTGAGCGCAAAACACCCGAAATCGAGAAAAAAG
GTTTTGGAGCTTCTTCGAGGGCATCTCCATCTCTTCCTTCTTGTGCGCTAACGAACAAAT
TCTGTCTTTGAAAAAAACAAACAAAATATTCTCATTTTGCAAAACAGTGATGTTCTCTTA
ACTTGATACGAAGATTTTGATACACGGGCTCAATCGGTTGTAGCCCAATCGAAACTGAGA
GGTGAAATCCTGTTCAAGGCCAATACTGTTTCTCCTGCTGAATGGCAAAGGTCGAAACTT
TCATTGCCATTTGTTGCTGATCCAAGTTTGATAAA
GenBank Accession CR398136 [GenBank]
Graphic View Graphic view of gene At1g02910
Predicted Position of Insertion Chr1:656568 - go to primer design
BLAST e Value 8e-106
Hit Clone Code (BAC ID) F22D16
Hit Gene Code At1g02910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation tetratricopeptide repeat (TPR)-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g40140

 
Sequence (A. th genome BLAST matches underlined)
>04-K025927-022-655-D01-8409
CTTTAGGTTAAGCCATGTTCTAGGGGTTATTCCATGATTGGACTGAATGTCCTTTTGTTC
ATCCTGGTGAGAATGCAAGGAGGAGAGATCCTAGGAAGTATCCTTACACTTGTGTGCCTT
GTCCCGAGTTTCGTAAAGGGTCTTGTCCTAAAGGAGATTCGTGTGAGTATGGGATCCTCC
CTATAGTGAGAGCTATNNACCCCACCTCTACCAAATAATGTTGTGAAGGTTCTTCCCTAG
AAGCTACCTCTCTTCCTTCAGTTGGGGTAACGAAAAGATTCTGTCTTTGAAAAAAACAAA
CAAAATATTCTCATTTTGCAAAACAGTGATGTTCTCTTAACTTGATAGGAAAATTTTGAT
ACGCGGGCTCAATCGGTTGTAGCCCAATCCAAACTGAGGGGGGGGGGGAGGTTCAAGGCC
TATACTGTTTCTCCTGGTGAATGGGATGGGCCGAAGCTTTCATTGCC
GenBank Accession CR398137 [GenBank]
Graphic View Graphic view of gene At2g40140
Predicted Position of Insertion Chr2:16773198 - go to primer design
BLAST e Value 6e-82
Hit Clone Code (BAC ID) T7M7
Hit Gene Code At2g40140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc finger (CCCH-type) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03