SimpleSearch - Line and FST details


Line specific information

 
Line ID 659E10
Vector Used pGABI1
Line Availability only available from NASC (N463226)
Segregation Analysis 50:50:40
Confirmed for Hit At3g18550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18550

 
Sequence (A. th genome BLAST matches underlined)
>77-K021151-022-659-E10-8409
AGCCATTTACATTGACATGAAAACAAGAAAATTAGAAAGAGAGATTTCTTTTTTTCCTTA
GCCTGCAAAATCAAGAAAAAAAAAGAGCAGTAATAGTGATTAGTCAGATAGTATGGGATC
CTCCCTATAGTGAGANNNNNNGGGATCCTCCCTAT
GenBank Accession BX660824 [GenBank]
Graphic View Graphic view of gene At3g18550
Predicted Position of Insertion Chr3:6383582 - go to primer design
BLAST e Value 3e-19
Hit Clone Code (BAC ID) K24M9
Hit Gene Code At3g18550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TCP family transcription factor
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MDK4

 
Sequence (A. th genome BLAST matches underlined)
>77-K021135-022-659-E10-8409
TGTATGCGGATCCTTTCTATAGAGAGATTTCTTTTTTTCCTTACCCTGCTAAATCAAGAA
AAAAAAAGAGCCGTAATAGTGATTAGTCAGATGGTATGGGATCCTCCCTATAGTGAGAAT
CCCACCATTTTCTATCAATTTGTTATTTGGGCTTTCGTTTGCATTTTTTGTTAGTTTTAG
GATAAGGGTGGGAGTTTGTTTATGTTTATTATGTGTCTTTAAAATTTGTATTGCTATTAT
C
GenBank Accession FR814228 [GenBank]
Graphic View Graphic view of sequence FR814228 of line 659E10
Predicted Position of Insertion Chr5:22010815 - go to primer design
BLAST e Value 2e-13
Hit Clone Code (BAC ID) MDK4
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40