SimpleSearch - Line and FST details


Line specific information

 
Line ID 659G04
Vector Used pGABI1
Line Availability only available from NASC (N463244)
Segregation Analysis 50:43:28
Confirmed for Hit At1g07640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g07640

 
Sequence (A. th genome BLAST matches underlined)
>31-K021151-022-659-G04-8409
GNAGCCATTTACATTGAATATATCCTGGTTTTTTTGAATGTTCTTTCTCTCTTTTTGTAA
TTTCTCTCTTAAATTCTTCATTGATGTTTTGATTCGTTTTAGTAATAATTTTGATTCATT
TCCAAAAGATATTCCTATTCCCATCTTCTTTTCTAATCCGCTTTCTTTAATATTCCAACA
TCTATATATATGGTATTTCTTCCTTTATAAATACGTATTGATAATTTGTTACACTAGTTG
TGAATTGAGTTTCTTGGTTCTTTCATTAATTTTGATTTGGTTTTGTAGCCTACGAATTCG
AATCATCAGCATCATCTTCAACACCAGCTTAACGAAAATGGAAGTATAATAAGTGGCCAC
GGACTAGTATGGGATCCTCCCTATAGTGAGATNNTNTGGGATCCTCCCTATAGAGAG
GenBank Accession BX660847 [GenBank]
Graphic View Graphic view of gene At1g07640
Predicted Position of Insertion Chr1:2355957 - go to primer design
BLAST e Value 6e-156
Hit Clone Code (BAC ID) F24B9
Hit Gene Code At1g07640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX660846 [GenBank]


Last Updated on 31.08.2016 09:40