SimpleSearch - Line and FST details


Line specific information

 
Line ID 659G11
Vector Used pGABI1
Line Availability only available from NASC (N463251)
Segregation Analysis 50:49:34
Confirmed for Hit At1g23870
Parent of DUPLO pair none
Parent of pair(s) 1574, 4740, 4767, 4779, 4795, 10085

Gene hit At1g23870

 
Sequence (A. th genome BLAST matches underlined)
>87-K021135-022-659-G11-8409
TGGGATCCTCCCTATAGTGAGACTCCCTTAACCCCCCCCTAACGGGGGCACGTTAAATCT
TCGCGATCTATGGAGCCTTCAATAGATTTACTCATATGGAACTATGTTCATGCCGCCTCC
TACTGTATTTCCCACGCAGCAGTCTGCCATAGCATAATAATCAGTCTTCTCGTAAAGAGG
AACGGGACGATCAATCAAGATCACTGGCTGATAACCAGCAAAACCATACCGCTCATTGAT
CCTTTTTGCAGTTGAATATGTCTCCTTCTTTGCTTCTTCCACATCCTTACCCGTGGCCCG
TGCTGGGTTCACTATCTGAATCAGGACAAGTTTTCCTCGCATATGCCAATATGTCTCAAA
GAGACGTTCCATGGCTATAAGTTTGAGGCTTATGCCTTTAAAGATGTCCATGTCGTCAAC
ACCAAGAATCAACTTTTTCCCCTTAAACTGTTCTTGTATCTCTTTCATTTTCGCTGCAGT
CGACGGAAGATTCAAAACCGATTCCAG
GenBank Accession BX660856 [GenBank]
Graphic View Graphic view of gene At1g23870
Predicted Position of Insertion Chr1:8434120 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T23E23
Hit Gene Code At1g23870 [TAIR] [MIPS] [SIGnAL]
Gene Annotation trehalose-phosphatase/synthase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23