SimpleSearch - Line and FST details


Line specific information

 
Line ID 663C11
Vector Used pAC161
Line Availability only available from NASC (N463587)
Segregation Analysis 50:48:45
Confirmed for Hit At2g34880
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34880

Sequence (A. th genome BLAST matches underlined)
>83-K023862-022-663-C11-8409
TACTCCCAATGGAGAATCTATGCCATCCTCTCTATAATGAGATGCATTCCCTTTCACAGT
TTGAATCATAGTCTTTATCCATCTTTACCAAGCTGAAACCATTTCCAAGAGCCTCAATTC
TTTTTTCTTCCATCCGTAACCGTGCCTCGATGGCCTTAGTTATGATACCGTCCTTCCCAC
AGAATCTCTTCCAGCTGAACCTTTTTGTATTATCTTCCCCATGTGCTGAGAGGGACTTAA
CAGCTTCAAAAGCTGCTCCAAGGAGAATTTTGTCTTGCTATACACACAGATACCCATTTC
ATCTCCAGATTGGGCCGAGATTATGCGAACATATACACTCATATACCTAAATACTGACAG
TTTGAGCTACCGCTTCCNTGGAGCCCCCTTTTTCCCCCCCCCCTTGGCGGGAAT
GenBank Accession BX894228 [GenBank]
Graphic View Graphic view of gene At2g34880
Predicted Position of Insertion Chr2:14712902 - go to primer design
BLAST e Value 2e-128
Hit Clone Code (BAC ID) F19I3
Hit Gene Code At2g34880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Yang et al. 2010, pkdm7c]


Last Updated on 07.07.2016 14:03