SimpleSearch - Line and FST details


Line specific information

 
Line ID 665B04
Vector Used pAC161
Line Availability only available from NASC (N463760)
Segregation Analysis 50:46:45
Confirmed for Hit At2g41110
Parent of DUPLO pair none
Parent of pair(s) 6395, 6397, 6398, 6400, 6401, 6403, 7814, 8871, 83158, 83421

Gene hit At2g41110

 
Sequence (A. th genome BLAST matches underlined)
>26-K023517-022-665-B04-8409
TGAAACCGTTTCTGATCTTTGTCGAAAAGTCTGAAAGCTTCCTTGAGTTCTTCCTCAGAG
TCAGTGTCCTTCATTTTCCTATGGGATCCTCCCCATAGTGAGTCGTATTACTCATGGGGC
TATCCTTAATTGGAACCTCACTGGGTTACCCCCTGTAGGGAGCGCCCCCAATAACGCCTT
TTCCCGAATTGCCCGGGGCTGGGGGGTTAGGGGGTGACAAAGGCCCTACCAATATCACCA
GCAACGCCAGCGTAGGAAAATGATACTTTTGAGTGCGTTACATGGTAGCTGCCTAGAAGA
AGTATTGCGTCGTCTGGCTGCGTAAGCGTTCTGCATATGTGTTAGTTACCCTAGAGCAGG
CTGTGTAGATAGATGTTCTGAATTTAGAT
GenBank Accession BX894324 [GenBank]
Graphic View Graphic view of gene At2g41110
Predicted Position of Insertion Chr2:17141043 - go to primer design
BLAST e Value 9e-29
Hit Clone Code (BAC ID) T3K9
Hit Gene Code At2g41110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calmodulin 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX894324 [GenBank]


Last Updated on 31.08.2016 09:40