SimpleSearch - Line and FST details


Line specific information

 
Line ID 668G12
Vector Used pAC161
Line Availability only available from NASC (N464116)
Segregation Analysis 50:50:46
Confirmed for Hit At2g28510
Parent of DUPLO pair none
Parent of pair(s) 7993

Gene hit T17D12

 
Sequence (A. th genome BLAST matches underlined)
>95-K024026-022-668-G12-8409
CATTTACATATGATACTATAATACAATTATATGATCGACAATCCGATCTCCGGGTATGGG
ATCCTCCCTAAAATGTGTTTTCCCAATTACTGTAAGGGATCCTCCCTATAGTGAGACTGA
ATAGAAGACATTTTATAACATTTTATGAAATCTCTTGTATGGGATCCTCCCTATAGTGAG
ATTGTATGGGATCCTCCCTATAGTGAGAATACTNCACCTNATANATATTCCTCTTCATAA
GCCACAAGAAATGATGAACTTCTTTTTTTATACTTTCCCCCCAGAACATAAATTTAATAG
CCCCTTTCCCCCGATAAAACCAAGCACNGATTCCTCCTTATATATAATAAACATCTCTTT
TATCTTAATGCACTTTCGTTCAGGCATATTATACCCAATCAAT
GenBank Accession BX894551 [GenBank]
Graphic View Graphic view of sequence BX894551 of line 668G12
Predicted Position of Insertion Chr2:12198719 - go to primer design
BLAST e Value 2e-11
Hit Clone Code (BAC ID) T17D12
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g28510

 
Sequence (A. th genome BLAST matches underlined)
>95-K023057-022-668-G12-8409
NGCTGAATCCGGACATGAGCATTTACATTGAATATATCCTGTGTTGAGATACTGGAGTGA
TCACTAACCATAGATGATGGTGGCATTCCCGTAATTATTGGGCCCTGAACCGGATGGGAT
CCTCCCTATAGTGAGTTATTGTT
GenBank Accession FR814305 [GenBank]
Graphic View Graphic view of gene At2g28510
Predicted Position of Insertion Chr2:12199829 - go to primer design
BLAST e Value 1e-05
Hit Clone Code (BAC ID) T17D12
Hit Gene Code At2g28510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR814305 [GenBank]


Last Updated on 31.08.2016 09:40