SimpleSearch - Line and FST details


Line specific information

 
Line ID 670F02
Vector Used pAC161
Line Availability only available from NASC (N464286)
Segregation Analysis 60:59:45
Confirmed for Hit At5g17040
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g17030 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At2g13630 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g17030

 
Sequence (A. th genome BLAST matches underlined)
>14-K022931-022-670-F02-8409
NNAGTCTGTATTCGGACATGAGCCATTTCATTGAATATATCCTGATGAGAAACAATCGCT
CACTGCTCATCTCTACCAAATCGATTGTATGGGATCCTCCCTATAGTGAGAGTAGTGGAG
TCTTCACGAAGGATGGATTTGAGGAGAGTTTGGATCGGGTATGGGATCCTCCCTATAGTG
AG
GenBank Accession BX661077 [GenBank]
Graphic View Graphic view of gene At5g17030
Predicted Position of Insertion Chr5:5603438 - go to primer design
BLAST e Value 7e-20
Hit Clone Code (BAC ID) F2K13
Hit Gene Code At5g17030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucosyl transferase 78D3
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g17040

 
Sequence (A. th genome BLAST matches underlined)
>14-K022931-022-670-F02-8409
NNAGTCTGTATTCGGACATGAGCCATTTCATTGAATATATCCTGATGAGAAACAATCGCT
CACTGCTCATCTCTACCAAATCGATTGTATGGGATCCTCCCTATAGTGAGAGTAGTGGAG
TCTTCACGAAGGATGGATTTGAGGAGAGTTTGGATCGGGTATGGGATCCTCCCTATAGTG
AG
GenBank Accession BX661077 [GenBank]
Graphic View Graphic view of gene At5g17040
Predicted Position of Insertion Chr5:5605595 - go to primer design
BLAST e Value 7e-20
Hit Clone Code (BAC ID) F2K13
Hit Gene Code At5g17040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g13630

 
Sequence (A. th genome BLAST matches underlined)
>14-K023074-022-670-F02-8409
ATTGAATTATCCTAGGATAATGACGATGATTATACTTACATTCTAGCATTCTCCATTTTT
GTTTTGCCCGTATGGAATCCTCCCTATAGTGAGGCC
GenBank Accession BX661078 [GenBank]
Graphic View Graphic view of gene At2g13630
Predicted Position of Insertion Chr2:5685034 - go to primer design
BLAST e Value 1e-18
Hit Clone Code (BAC ID) T10F5
Hit Gene Code At2g13630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box associated ubiquitination effector family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 606E12


Last Updated on 31.08.2016 09:40