SimpleSearch - Line and FST details


Line specific information

 
Line ID 676A09
Vector Used pAC161
Line Availability only available from NASC (N464809)
Segregation Analysis 50:50:35
Confirmed for Hit At3g02830
Parent of DUPLO pair 2355
Parent of pair(s) none

Gene hit At3g02830

 
Sequence (A. th genome BLAST matches underlined)
>65-K023062-022-676-A09-8409
AGCCATTTACAATTGAATATATCCTGCCGAATGGCTTCAATTGAATTGCAATGTCTCCGG
GAACACATTTTCCCTCGGCAATGCATAATACCCTCCTAGCGGAACAGAGGATCCCGGATT
GTAACCCGAGAATGATCCTTGAGACTGAGAGCCTGACTCTATTGTCTCGTTCTGCTGTAA
ATTTCTGTAGTTTTGATCATTTCCAGTATGGGATCCTCCCTATAGTGAGCCCACTCTCTT
ACTGAAATGGGTACACCCTGAAAAACTCTCTTGCTTGTGATATCCCCACACTCTTCAGGT
TGATTGGTGTAAACTCTGACCCCCCAGATTTTTGTTATGTTCGTTATACCCCCCTACACC
GTTTTATCTGTGTTAACATCGTCAACAGAAGAGTAAACAGCCTTTCCCCAGACAATTGTG
GTGCCCCCTACAAAAACCCTCCCTCCCCACCAATCTTCTTCTTTTTCT
GenBank Accession BX661494 [GenBank]
Graphic View Graphic view of gene At3g02830
Predicted Position of Insertion Chr3:615471 - go to primer design
BLAST e Value 4e-80
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc finger protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX661493 [GenBank] BX661494 [GenBank]


Last Updated on 31.08.2016 09:40