SimpleSearch - Line and FST details


Line specific information

 
Line ID 676A09
Vector Used pAC161
Line Availability only available from NASC (N464809)
Segregation Analysis 50:50:35
Confirmed for Hit At3g02830
Parent of DUPLO pair 2355
Parent of pair(s) none

Gene hit At3g02830

 
Sequence (A. th genome BLAST matches underlined)
>73-K118365-0022-676-A09C-8409
CATTTACATTGAATATATCCTGCCAAATGGCTTCAATATTCAAAGACAGGTTCATTTGTT
CCGGGTTACAATTGCCGAATGCCAATTCTACATGAAGACAGGTGACTGCAAATTTGGCAC
AGTTTGCAAATTTCACCATCCTAGAGACAGACAAGCTCCTCCTCCTGATTGTCTCTTAAG
CTCCATTGGCCTCCCCTTACGCCCGGTAAGCTCAAAGACTTGTGCATAATTACTTGGTTC
TCTTCGATTAAATCTCTGCATTGTTTGATTTTTTTTCTTTCTCAAAATGATAGGGAGAAC
CGTTGTGTGTGTTCTATACACGCTATGGAATCTGCAAATTTGGTCCAAGCTGTAAATTTG
ATCACCCAATGCGAGTATTCACATACGACACNACAGCT
GenBank Accession HG969079 [GenBank]
Graphic View Graphic view of gene At3g02830
Predicted Position of Insertion Chr3:615467 - go to primer design
BLAST e Value 9e-179
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02830 [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc finger protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23