SimpleSearch - Line and FST details


Line specific information

 
Line ID 679F09
Vector Used pAC161
Line Availability only available from NASC (N465157)
Segregation Analysis 50:44:29
Confirmed for Hit At4g30030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g30030

 
Sequence (A. th genome BLAST matches underlined)
>70-K023927-022-679-F09-8409
CCTTTACCCTGAAATATTCGCTACCTGTATCTATGAGTAAGAGTTACGGGACGGGTGGAT
TGCCGATAGAAATATTTGCGAGGAATGCTGCTGGATTCGGAATAGGAGTGACGTGTGAGA
CGGTCCACAAGTTATCTATGGGATCCTCCCTATAGTGAGGGAGAAGACGCACGATTTTTT
ACCTTTTTTTATTTTCAGGGGGGGGTGTATATGCCCACACCTATAATAAAACACTGAGAG
ACATTGTGATAAAACGACCATTTAGTATCCGTAGAATTTATGAGCCAAGGCAACCA
GenBank Accession BX894604 [GenBank]
Graphic View Graphic view of gene At4g30030
Predicted Position of Insertion Chr4:14683189 - go to primer design
BLAST e Value 6e-51
Hit Clone Code (BAC ID) F6G3
Hit Gene Code At4g30030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Eukaryotic aspartyl protease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX661865 [GenBank]


Last Updated on 31.08.2016 09:40