SimpleSearch - Line and FST details


Line specific information

 
Line ID 684H02
Vector Used pAC161
Line Availability available as T3 set from NASC (N465654)
Segregation Analysis 50:42:41
Confirmed for Hit At5g45110
Parent of DUPLO pair 2429
Parent of pair(s) none

Gene hit At5g45110

 
Sequence (A. th genome BLAST matches underlined) 
>16-K023047-022-684-H02-8409
TTTGGTCATAAATTCGCGACAGGAACCATGTACGATTGAATATATCCTGCGCATGCACCC
ACTATCTGATACCCAGATTTCGGAAGATGAGCTTCTTACAATTGAAAGCAACCATAAGAA
TGGGAAGAACATTCTCAACAAGGGTCTTCTCCCAAAGTTACAAAGCCGCCGCTGCAAGCA
CACAAACCTTTTAGTTCTCATTGAGGGCT
GenBank Accession BX662096 [GenBank]
Graphic View Graphic view of gene At5g45110
Predicted Position of Insertion Chr5:18230056 - go to primer design
BLAST e Value 1e-52
Hit Clone Code (BAC ID) K17O22
Hit Gene Code At5g45110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NPR1-like protein 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37