SimpleSearch - Line and FST details


Line specific information

 
Line ID 687A01
Vector Used pAC161
Line Availability only available from NASC (N465857)
Segregation Analysis 50:50:42
Confirmed for Hit At1g03440
Parent of DUPLO pair 2711
Parent of pair(s) none

Gene hit At1g03440

 
Sequence (A. th genome BLAST matches underlined)
>01-K023113-022-687-A01-8409
GTTCTTCGAGTCTTGGGATTTCACTTCTGATCCATGCGGCTTCGCTGGCGNCTACTGCAA
CGGAAATAAANNAATCTCTCTCAATCTCCGCGATCCTATGGGATCCTCCCTATAGCGAGA
CAAATCAAGATTGGACGGAGACAACAAAGAAGACAGACCCACAACCATCGCAACAGAGGG
GAGGGGGAACAAAGCGACAGACAAAGAAAGAAAAGAAGCAACAAAGCGACGCGCGCACAG
AGCAACGCAAAGAAGAGCAAGCGCGAAAGGACACGAGCGAAGCGGCGAGAGCGGAAAAGG
AGCAGAAACACCGAAGAGACAAGCAAACAAAACAACAGGGGAACGCGAAAACAGAAACAG
AACAGGCGCGCAGAAAACCCATGTGAATCTTCCAGATTGGGGCTGAGATTATGCCAAAAG
ATATACGCATCATATACAGAAATAACTGACAG
GenBank Accession BX662198 [GenBank]
Graphic View Graphic view of gene At1g03440
Predicted Position of Insertion Chr1:852824 - go to primer design
BLAST e Value 2e-38
Hit Clone Code (BAC ID) F21B7
Hit Gene Code At1g03440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat (LRR) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662197 [GenBank]


Last Updated on 07.07.2016 14:03