SimpleSearch - Line and FST details


Line specific information

 
Line ID 689C11
Vector Used pAC161
Line Availability available as T3 set from NASC (N466083)
Segregation Analysis 50:40:25
Confirmed for Hit At1g72755
Parent of DUPLO pair none
Parent of pair(s) 1003, 8040

Gene hit At1g72755

 
Sequence (A. th genome BLAST matches underlined) 
>83-K022969-022-689-C11-8409
TGTTTTCGACTGACCCATGATCTGCCTCTGTAATTANGCGCCGTCGATGGTAAAGAAAAG
GATATGCCATCCTCCCTATAGTGAGCCGTATTACTC
GenBank Accession FR814609 [GenBank]
Graphic View Graphic view of gene At1g72755
Predicted Position of Insertion Chr1:27383619 - go to primer design
BLAST e Value 0.95
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72755 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences


Last Updated on 10.06.2021 13:37