SimpleSearch - Line and FST details


Line specific information

 
Line ID 692F09
Vector Used pGABI1
Line Availability only available from NASC (N466405)
Segregation Analysis 50:28:17
Confirmed for Hit At1g55210
Parent of DUPLO pair none
Parent of pair(s) 417, 11241, 84814, 84815, 84818, 84820

Gene hit At1g55210

 
Sequence (A. th genome BLAST matches underlined)
>70-K025067-022-692-F09-8409
NNNTTCCGTGCTATTCCGGACATNAGCCATTTACAATTGAATATATCGAGCACGAACACT
TTGATGTGGATAATGTTTCCCCTTTTAGTGGATTCCTTCACGAGTGTCAGGACCATGAAT
CTTATTAAGTCTTCACTGGCACGGGATCCTCACTACACGGAGAGAAAGAGGATTTGGACG
GCGAGGAAGAAAATGAGCTTAGCCATGTGTTTTGTTGTGGTTTTGGTTACTATGGTTGGT
TTGTTTACCTACGTGGTGTAAAAAACAAGGTGGTGTGATGCTTTTATATATATGTCAAAT
TTTAGACATCTTTCTAGAAATTAATTAAAACAAAATATCTTGTTTAATTCCTGGATTCGT
TTAATATTTTTCTGAAGTAGCTACAGAATATTGACTAGGGTATGGACGAATTTTAGTTTA
TTTACCAAATAAAAAAACGTAATCGGGTGTGGGTC
GenBank Accession BX943811 [GenBank]
Graphic View Graphic view of gene At1g55210
Predicted Position of Insertion Chr1:20598473 - go to primer design
BLAST e Value 3e-130
Hit Clone Code (BAC ID) F7A10
Hit Gene Code At1g55210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance-responsive (dirigent-like protein) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g64530

 
Sequence (A. th genome BLAST matches underlined)
>70-K025071-022-692-F09-8409
TTTACATTGAATATAATGACTATGAACAAAGCAATGTTGATAATGGTTCACCAATTAATA
GATTCCTTCCGAGGGAATAAAAAAGAAAGTTATTAGGTAAAGACTGGTATGGGATCCTCC
CTATAGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession BX943812 [GenBank]
Graphic View Graphic view of gene At5g64530
Predicted Position of Insertion Chr5:25795868 - go to primer design
BLAST e Value 4e-46
Hit Clone Code (BAC ID) MUB3
Hit Gene Code At5g64530 [TAIR] [MIPS] [SIGnAL]
Gene Annotation xylem NAC domain 1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23