SimpleSearch - Line and FST details


Line specific information

 
Line ID 695B02
Vector Used pAC161
Line Availability only available from NASC (N466638)
Segregation Analysis 50:50:37
Confirmed for Hit F15O5
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15O5

 
Sequence (A. th genome BLAST matches underlined)
>10-K024553-022-695-B02-8409
TGGGATCCTCCCTATAGTGAGTACTATGTAAACCTCCCCGCATCGGGCAAGTTGAATTAC
GCACCCTCTCGTTACCATTATTGAGGGAGGAATTTGACGACCTATTGTACTTGTAGCCTG
CGTGGAATGGTAGAAGTGATCACCGCTGTGTTATAATTCATGTTCGTACCTATGAGAGCC
TCCCTATAGGGTCTCCTATTACTTGATCGTGCACGCAAATATGTTCATTTGGCAACTACC
ATGCACCATTTGTAAATATTACTAATAAAAGACTTCTGTATCCGCTTCAAATGGGGCTGA
AATTAAGCTGACATATCCACTCATAAATATAAATACGGACGAGTTGATCTACCATTTCAC
TGTACCCACTTGAGCTAAAGCTACCGGAAAACCTAGTATCTAAAGGCCGTGATACAATAC
ATGATAATATAACATTC
GenBank Accession BX944107 [GenBank]
Graphic View Graphic view of sequence BX944107 of line 695B02
Predicted Position of Insertion Chr5:25998731 - go to primer design
BLAST e Value 4e-09
Hit Clone Code (BAC ID) F15O5
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences


Last Updated on 31.08.2016 09:40