SimpleSearch - Line and FST details


Line specific information

 
Line ID 696C04
Vector Used pAC161
Line Availability only available from NASC (N466748)
Segregation Analysis 50:49:42
Confirmed for Hit At1g74700
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g74700

 
Sequence (A. th genome BLAST matches underlined)
>27-K024559-022-696-C04-8409
GTGACATGAATATATCTGCACCTAAATCGAGTCAGAAATAATATATAACCTTTGACCCAA
GTTGGTCCTCTATGGGATCCTCCCTATAGTGAGTCGAATTAATCCGCGTGGTTCGCAGGC
TCTAGGTAGGCTTATGCAGAATTGTTCTTAAGGCAGAAAGTCGAATGAAGGATCTTTGCG
AAATATAATCCGAAATTTCAAGTCTTTTTATAGAAGATTCAAGATACTTACGATATGATC
CATGTGAGAGTGAGAGATAAAGAGTGATTCTCGAGAAATTGTACATAGGTGTGTACTGTA
CGTAGTTCAAACTTTCTTTTGTTTCAGATGAAGATATGGGAGGATGTATTGATGGAAAGA
GTATGAGTGAGGTGCGACCGATAATGATGGGTTGTGTAGAATCGTCGAGTGGTGAGGCTT
GTTAATGATGTTAAGATAAGA
GenBank Accession BX944240 [GenBank]
Graphic View Graphic view of gene At1g74700
Predicted Position of Insertion Chr1:28065755 - go to primer design
BLAST e Value 2e-48
Hit Clone Code (BAC ID) F1M20
Hit Gene Code At1g74700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation tRNAse Z1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T9H9

 
Sequence (A. th genome BLAST matches underlined)
>27-K024554-022-696-C04-8409
TTTTAAATTCGAAATCTTATTACAGTGACTTGAATATATCTCACCTATTAAAGTCTGATT
TAATATATAACTTTGACCCAATTGCTCCTCTATGGGATCCTCCCTATAGTGAGATATATT
GAGACAAAATACGCTTTCATATCTAATTTGATTCCCAACTGAGGATGTGCGACATTTATT
CTTATATTGACTTAATTGCTATGAAAGACTACGTATTTCGACTCATTTCAAATAGAAGAG
ATAACTAATGGAAAAATTTTATTTTTCTTCGTAAAAAATAAATTTCGTTAGGATCTACAA
ATTACATTTTATAAGTTATGTATAAATATAGTTACAATAATTGAAAAATGTCCGTAGATT
TCGATCATATCATAAGATAAACGATGTTCATTCTTCCAGATATGGAGATGAATAGATAGA
GTTCCTATTATATAACGCTACTTAATTCGTTAAAATTAAAGGAGCACAATTGAACCAACC
AAATTCTAAATTCATAATTGCATCAATATATATAAATATAATAATTTTAAAAGAAGATAG
ATACAACATATTTAAAATAGGAAAGTAATACTACTATAATCAAGTTGAAAAATTATAAAT
ATATA
GenBank Accession BX944239 [GenBank]
Graphic View Graphic view of sequence BX944239 of line 696C04
Predicted Position of Insertion Chr2:13484369 - go to primer design
BLAST e Value 7e-11
Hit Clone Code (BAC ID) T9H9
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03