SimpleSearch - Line and FST details


Line specific information

 
Line ID 696G09
Vector Used pAC161
Line Availability only available from NASC (N466801)
Segregation Analysis 50:32:27
Confirmed for Hit At2g47210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T5K6

 
Sequence (A. th genome BLAST matches underlined)
>71-K024554-022-696-G09-8409
TCATTAAATGAGATCAAAGTCTTAGATCGTTTAGATTATGTGTAGCTATTTCTCGTACCA
AAATATGCAAGTTTCTATTCCTGCAGATCTCATATTGAGCAGCAAAACATTGGGTTTATA
GGAGGCGACGTCAAATTTAAGAGCCCTAAACGATTCCATAATTGGGAACTTCATATAAGC
CGGACATATCACGTCGAACAAAAGATCGCAAACAAATATTTGTATATACAATTTAATTTA
AAGATATAAATGTTTAATGTTTCAACTTTCAAGATGTAAAAAAGTGTTATCAATTAATTC
GTGGCCGCACATGCGGAAGATTGCCTATGGGACCCTCCCTATAGGGAGCAACAAAACATT
GGGTTTAAAGGAGGCGACG
GenBank Accession BX944306 [GenBank]
Graphic View Graphic view of sequence BX944306 of line 696G09
Predicted Position of Insertion Chr5:3476169 - go to primer design
BLAST e Value 9e-152
Hit Clone Code (BAC ID) T5K6
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit BX944307 [GenBank]

Gene hit At2g47210

 
Sequence (A. th genome BLAST matches underlined)
>71-K024559-022-696-G09-8409
ACCCAATGGTAAAGCTGCAAATCATCTTTCCTATGGGATCCTCCCTATAGTGAGACCAAT
GAAACACTCCTATAGAGTGACTTAATAACTCGCTGATCCAAGGTTGAAGGTTTGAATTCG
TGAAAATATCATATTGCGCAAAGATATCTTGGGGTTATAGGAGGCTACGTGAAATTTAAA
AGCCCAAAACGATTCTGTAATTGGGAACTTCCTATAAGCCGGACATATCTAGTCAAACAA
AAGATCGCAAACATATATTTGTATATACAATTTAGTTTATAGATATAAATGTTTAACGCG
AGACTAAGGGATACTTCCTAAAGTGAGAAAAATTGATCCGAGGAATAACCGGGATTAGAG
AAATAGGGAGAGTTGGCATATCAGGTTAAAGGAAGCCCATGA
GenBank Accession BX944307 [GenBank]
Graphic View Graphic view of gene At2g47210
Predicted Position of Insertion Chr2:19379524 - go to primer design
BLAST e Value 9e-10
Hit Clone Code (BAC ID) T8I13
Hit Gene Code At2g47210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb-like transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40