SimpleSearch - Line and FST details


Line specific information

 
Line ID 699B09
Vector Used pGABI1
Line Availability only available from NASC (N467029)
Segregation Analysis 50:32:27
Confirmed for Hit At3g61830
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g61830

 
Sequence (A. th genome BLAST matches underlined)
>66-K025073-022-699-B09-8409
TCCGCGAAGNAGCCATTTACAATTGCAAAGAGTCTGCTCCTACTTCTGGTACTAGTTCAT
GCAGTTGATTTGGAGGCATACTTGTATAATCAATGTTGATAGGTTCTAGTGCCCCTGAAT
CAGTCAAGGACATTCTGAGTTGGAAGCGTAGCATCATTTGTATGAAGATTAGGCACCCAT
CTCGTTACGACCTTACGAGGATGCATCTTCTGAAACAACAATCTCTTCTTATTGACGAGA
AGGTTTTTGATACTCATGGTACTGGACTTCTTTTCATGGTGATGGAAACTCCAACTCGAG
CCTGGATTTCTTGGTCCCCCTATTGGTGGACCAACTAACCAAGAGTTCCATTCGTTTGTT
AAAATTTTAACGGCTTCAAAAACAAGCACTCATGGGGGATTCCCTGTTCTTCCTAAACAC
GCCACTGAATGCTTGCCTTCTTTGGGAAATATATTCTTAAAGAAACCTTCTCAATTCAAG
AAACTTTAACTTGAATTCTCCCTCCAATTTTACCCTTTTTAGGAAATGACACAAGCTACT
CCTACTCAAGA
GenBank Accession BX944508 [GenBank]
Graphic View Graphic view of gene At3g61830
Predicted Position of Insertion Chr3:22888757 - go to primer design
BLAST e Value 7e-97
Hit Clone Code (BAC ID) F15G16
Hit Gene Code At3g61830 [TAIR] [MIPS] [SIGnAL]
Gene Annotation auxin response factor 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23