SimpleSearch - Line and FST details


Line specific information

 
Line ID 701C12
Vector Used pAC161
Line Availability only available from NASC (N467236)
Segregation Analysis 50:49:37
Confirmed for Hit At4g01120
Parent of DUPLO pair 2460
Parent of pair(s) none

Gene hit At4g01120

 
Sequence (A. th genome BLAST matches underlined)
>91-K025311-022-701-C12-8409
AACCATTTACATTGAATATTTGTGACACTCCCTAAATTATTGTATGCTTTTAATGGTTAC
AACTATTTAAAGCTAATGGCTTTTGTACTTGGTAGGTGAAAGACCCTCATCTCAAAACAG
TCTGCCTCTTAGAGGTGAAAATGAGAAACCCGATGTGACTATGGGGACTCCTGTTATGCC
CACAGCAATGAGTTTCCAAAACTCTGCTGGCATGAACGGTGTGCCACAGCCATGGGTATA
GTATTCTTGTGCCACTCTCGTTGACTTCATTTATTCGTGACATCCCCTTTTGTTTGTTTA
TTGGTGTTAGTGTGTGTTTATCTGCANAATGAAAAAGAGGTTAAACGAGAGAAGAGAAAA
CAGTCAAACCGAGAATCTGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR356596 [GenBank]
Graphic View Graphic view of gene At4g01120
Predicted Position of Insertion Chr4:482737 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F2N1
Hit Gene Code At4g01120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation G-box binding factor 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03