SimpleSearch - Line and FST details


Line specific information

 
Line ID 701F12
Vector Used pAC161
Line Availability only available from NASC (N467272)
Segregation Analysis 50:50:47
Confirmed for Hit At2g34310
Parent of DUPLO pair none
Parent of pair(s) 7917

Gene hit At2g34310

 
Sequence (A. th genome BLAST matches underlined)
>94-K025352-022-701-F12-8409
AAACTGAAACTGCTAATTTTACATCAGACAAACAAAAAAGGTACTGAAACTGCAGTAACA
AGACTATGGGATCCTCCCTATAGTGAGCACAAATGATCACTACCAAGATAGGAAAAAACA
TCCAGCACTTGTTGCAACTTGCAAGTATCCAGAAGCAACACAGAGACAACTCAGACATGA
TGTGATTAGAGTAAAGTCACAAACTTTGGAACAATAATTAAACAGAGATTGGCTAAATCT
CAATACCCCATCAGATTCATCCCCACCCACCAAAAATTCCCTATAAAGTAGGACCAAAGC
ATCATTCACTTCGTTTTGTATAATACCAAAAGAAGAAACTTTACCTAACACCAGAAACCC
ATTTGAGACATAAAATCCTGTAAACAGCAACTATGGGATCCTCCCTATAGTGAGACNTAT
TACTCNCCCCCTT
GenBank Accession CR356649 [GenBank]
Graphic View Graphic view of gene At2g34310
Predicted Position of Insertion Chr2:14479256 - go to primer design
BLAST e Value 2e-162
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR356648 [GenBank]


Last Updated on 07.07.2016 14:03