SimpleSearch - Line and FST details


Line specific information

 
Line ID 703E09
Vector Used pGABI1
Line Availability only available from NASC (N467449)
Segregation Analysis 50:49:38
Confirmed for Hit At3g01270
Parent of DUPLO pair none
Parent of pair(s) 85696, 85713, 85772, 85826, 85832, 85851, 85854, 85866, 85867

Gene hit MOE17

 
Sequence (A. th genome BLAST matches underlined)
>69-K025034-022-703-E09-8409
CGGAATGAGCCATTTACATTGAATATATTCAATTGCCAAATTGGTAATGTATGGGATCCT
CCCTATAGTGAGACAAAAACAAAAACAAAAACAAAAGCAAAAGCAAAAGCAAATGCTTGT
ATGAGTCATAACAAACTGAAGACACACAAAAAAGAAAAAAAGAAAAAAAACAAACAAAAA
ATTAGTCTTATATTCCCCATGTGCTAAGATTAACAAAAGTTACTGTCGGCCTAAACAAGA
CTAGCATAGAGAAAGATAACTAATGGGCCGATTCAAATCAATGATGAAATTAGACCGAAA
TGAACTTTAAGAGAAAGTATTTAGAAAAAGTGAATGCTCAATTCACTAAATTACATGTGT
TCCAATTAGATTTAGAGCTAGGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX944900 [GenBank]
Graphic View Graphic view of sequence BX944900 of line 703E09
Predicted Position of Insertion Chr3:7292985 - go to primer design
BLAST e Value 3e-111
Hit Clone Code (BAC ID) MOE17
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g01270

 
Sequence (A. th genome BLAST matches underlined)
>69-K025105-022-703-E09-8409
AGCCAAATGCTTTGTTGCCCCAAAGATAGACATACCATCTCCATCAGCACTCTCCTCTAT
GCCCAAAGTGGTTAATCCAATCTCTTATCAAACCACCACTGCTTTTTCACGATGTGGTGG
ACGTGAAGCCCATGGATGATGATATTGTGCACGTATGGGATCCTCACGAGATGGAGCTTG
GTGCACAAAACAACAACATGGATGACAAGAAGATGCAAGTCACAGTGGCTTACAACCATT
TCGGAAAAGGACTTGTGCAGAGGATGCCTAGGGTCCGATGGGGTTTCGTCCACGTTGTCA
ACAATGACTACACTCATTGGGAGCTTTACGCGATCGGTGGTAGCCAAGGTCCTACCATTC
TCAGCCATGGAAACCGTTTCATCGCTCCTCCTCACAAACAACACTACAGAGAGGTCCAAA
ATGATTTGAGTGTGCACATATATATATGGCATCAAATCAAAGTATGGGATCCTCCCTATA
GTGAG
GenBank Accession BX944901 [GenBank]
Graphic View Graphic view of gene At3g01270
Predicted Position of Insertion Chr3:83593 - go to primer design
BLAST e Value 2e-162
Hit Clone Code (BAC ID) T4P13
Hit Gene Code At3g01270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectate lyase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR356775 [GenBank]


Last Updated on 31.08.2016 09:40