SimpleSearch - Line and FST details


Line specific information

 
Line ID 705E04
Vector Used pGABI1
Line Availability only available from NASC (N467636)
Segregation Analysis 50:50:47
Confirmed for Hit At3g61850
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g61850

 
Sequence (A. th genome BLAST matches underlined)
>29-K025107-022-705-E04-8409
AATAACCAGTCTATATTAAAACACATCCTATTGATATCTCTATATAGACTATCTGTATAA
CCACTACCGGTTTCCTACATACCTATAAACCTGCATACCCCCCCCTGTATATATTTATGT
GAGTAGAGAGATAACAAGAGAGAGAGAGAGAGAGAGAGAGCGTAAGAGTCGGGGAGAAGC
TAGAAACAGACAGATATAGCAGAGAGATCTCTTTTTACGTATGGGATCCTCCCTATAGTG
AG
GenBank Accession BX945100 [GenBank]
Graphic View Graphic view of gene At3g61850
Predicted Position of Insertion Chr3:22895733 - go to primer design
BLAST e Value 6e-36
Hit Clone Code (BAC ID) F21F14
Hit Gene Code At3g61850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03