SimpleSearch - Line and FST details


Line specific information

 
Line ID 710G03
Vector Used pGABI1
Line Availability only available from NASC (N468139)
Segregation Analysis 50:42:32
Confirmed for Hit At1g49710
Parent of DUPLO pair 380
Parent of pair(s) none

Gene hit At1g49710

 
Sequence (A. th genome BLAST matches underlined)
>23-K022876-022-710-G03-8409
CCATTTACATCACATCAAACTGATCTTTGTCTACCAATGTATAATTTGCCTGATTTACTT
ATGTTACCTTTCCCATCCCGGTTTCGATGACAACCACCATAAGAATCAATCTTAATGTTA
GTTTTCATCAATGCCTCAAGTGCTTGTAGACGAAAATTCCGAGCACCACAATTAGAAATA
AAAGCAGCTGCAATAGCTCTCTCAGTTTTTGGCTGTATGGGATCCTCCCTATAGTGAGGC
TGTATGGGATCCTCCCTATAGTGAGA
GenBank Accession BX663098 [GenBank]
Graphic View Graphic view of gene At1g49710
Predicted Position of Insertion Chr1:18392714 - go to primer design
BLAST e Value 3e-102
Hit Clone Code (BAC ID) F14J22
Hit Gene Code At1g49710 [TAIR] [MIPS] [SIGnAL]
Gene Annotation fucosyltransferase 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23