SimpleSearch - Line and FST details


Line specific information

 
Line ID 715B09
Vector Used pGABI1
Line Availability only available from NASC (N468565)
Segregation Analysis 50:50:50
Confirmed for Hit At5g56270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g56270

 
Sequence (A. th genome BLAST matches underlined)
>66-K025039-022-715-B09-8409
GNAGCCATTTACATTGAATATATCCTGCGGCTGATGCGCCTCTGTTACCGTTGCCACTAT
CACCGCCGCCTCCGATGGCTGCTGTTGCCTGCAACGGGGACGTCTTGGTTAGGTTTGCCT
TCCTAGGGTGTTATCCCCCATTTGAGATCATGAAAAGCTCTTTCGACTGGTTTCCTCGGG
GTATGGAATCCTCCTCCGTCGGAGGGCGTTGCGAGAGAAGCAGTCGATCCGTGAGATCAG
CCGACGCACCGGGCAGGCGCGCAACACGATCGCAAAGTATTTGAACGCAGGTATGGGATC
CTCCCTATAGTGAG
GenBank Accession FR814936 [GenBank]
Graphic View Graphic view of gene At5g56270
Predicted Position of Insertion Chr5:22782781 - go to primer design
BLAST e Value 8e-29
Hit Clone Code (BAC ID) K24C1
Hit Gene Code At5g56270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23