SimpleSearch - Line and FST details


Line specific information

 
Line ID 716H09
Vector Used pGABI1
Line Availability only available from NASC (N468733)
Segregation Analysis 50:48:38
Confirmed for Hit At1g60390
Parent of DUPLO pair none
Parent of pair(s) 441, 9664

Gene hit T11I18

 
Sequence (A. th genome BLAST matches underlined)
>72-K025111-022-716-H09-8409
GNAGCCATTTACAATTGAATATATCCTGACACTATATCCGATTTCCGAGAGCCTTTACTG
ATCTAGGTTATGACAACACAATTAAGGGCTTATGGTATTTTTTTATATAAGGTGAGGTAA
GAAGCAAAATTATGGATCGATGCCTAAGATAAAGATCGTATCCCCTTGGAATCATCTTTG
AAGCCATCTAAGACTCGTTTATGAAGCATCATCCCTTTTACATATGTGCAATGAAAGAAT
AATTTTAGATGCGATACCGATAGATATGGTGTGTTGATTAGCTTACGGAGTCTAATCACA
TACACACTCAATTTTTTGTCCTAGCCAAGAAAACCCATGTTTGCGACCGATCATTTTATA
TATAATTTTTGGCCTAAAATTTGTAAAAGTTTTCTTGAGTTGAATTCAAAATTAACGGAT
TTTCATATTTTAATGTTGTCAATATCGAAACCATATTTGTATATTTCTCGCGAATGATTA
GCATAGTTTTAATATATCCCAACCACCACTCCTTTTGTATGTGAATGTTACTATTAAC
GenBank Accession CR356997 [GenBank]
Graphic View Graphic view of sequence CR356997 of line 716H09
Predicted Position of Insertion Chr3:1020504 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T11I18
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g60390

 
Sequence (A. th genome BLAST matches underlined)
>14-K117831w-0022-716-H09C-CR3S
CATAAATTTCTATTCCTAAAACCAAAATCGGTCCTTGGCCGTAAGTTTTGATGCTGACGT
TACCTCCGACGTTATCTTGGCCGTAACCGGTGAAATTATCAGAGCCAAGGTTAAAAGATT
TACCGTAATTTACGAAATTGACCTTCTCGTTGTTTGAGTTTTTAGCGTAAGAAGAGAAAG
AATCAACTCCGATGTTTGATTGGTCTCTGTAATTTTTAAACCCATAAACGGCGCCGTTAC
CTCCGTCACCGTATCCTTTAAATTCGTTAACCGGAACATTACCGTTTTCTCCGTAGCTCG
TGAAACTGTCGTTAGCTCCGTTAGCGGATTCTCCGTATTTGGTAAAACCCGTATTAACTA
CGTTTGACCCGGTTCCGTAACCCGAGAACTCATTCGGAGCTCCGTTTCCGTTTTTGCTGT
AGCTTGTGAATGATTGATATCCGGTGTTGCCGTTCTCGGAGTAGGTAGTGAAGGTTTGTG
ATCTTCCGTTGGCTTTATCGGAGTAAGAAGTGAATCTTCCGTTTGGTTCGTTTGCGTCTG
TGTTGTATTCCGTGAATT
GenBank Accession HG969096 [GenBank]
Graphic View Graphic view of gene At1g60390
Predicted Position of Insertion Chr1:22248366 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T13D8
Hit Gene Code At1g60390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation polygalacturonase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX945548 [GenBank]


Last Updated on 31.08.2016 09:40