SimpleSearch - Line and FST details


Line specific information

 
Line ID 717A10
Vector Used pGABI1
Line Availability only available from NASC (N468746)
Segregation Analysis 50:50:36
Confirmed for Hit At4g13240
Parent of DUPLO pair none
Parent of pair(s) 3994, 4037, 4166

Gene hit At4g13240

 
Sequence (A. th genome BLAST matches underlined)
>73-K025280-022-717-A10-8409
AGTTCTGTCAGAATGGCTATCCCTGATAGCTATATCGAGTCTCTTCCAAGGTGATCTTCC
TTTTTTGTCTTAAAACCGGTATATAGTTTGGATGATTTGCTTGCATTTATTTTAAAATAT
CATATACTATTTTAAGCAAATCAATAATGGTTATTAAGAAGACTTAGATTATTTTCAGAA
TGGAAGAGTAAGCCTTGGGGATTCGTTATACAAGAGCATAACAGAAGAGTGGTTTGATCC
AGAGCAGTTCTTGTCAACACTTGACTTATCTACAGAGCACAAAGTGTTGGATGTGAAGAA
TAGGATTGAGGCCTCAATCGTTATATGGAAAAGAAAACTTCATCTAAAAGACAACAAATC
TTCTTGGGGATCAGCTGTGAGCTTGGAGAAACGAGAGTTGTTCGAAGAGAGAGCCGAGAC
GATCTTGGTCTTGCTTAAACAAAAGTTCCCTGGTCTTCCCCAATCTTCCCTTGACATTTC
CAAAATTCAGTATAACAAGGTAATGCTCAAATGTTATTGCT
GenBank Accession CR357015 [GenBank]
Graphic View Graphic view of gene At4g13240
Predicted Position of Insertion Chr4:7681299 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F17N18
Hit Gene Code At4g13240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RHO guanyl-nucleotide exchange factor 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23