SimpleSearch - Line and FST details


Line specific information

 
Line ID 718H12
Vector Used pGABI1
Line Availability only available from NASC (N468928)
Segregation Analysis 50:50:45
Confirmed for Hit At1g20925
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g20925

 
Sequence (A. th genome BLAST matches underlined)
>96-K025307-022-718-H12-8409
GACAGAAGCCATTTACATTGAATATCCGCGAATGATGCATGCGTGTCGACCGTACGGAAT
CCTCCCTATATTGAGACANCCGGTATGGAACCCTCCCTAATAAGATTACATTTTAAGGAC
GAATCGGTTCTATGAGTACCTCCCAATTACGTCTTCACGGTGCCTTCGTATGAGAGAGTC
TACGAAAAACCGCCTAAATGCATACAAGGAGGAGGGAGCAAAAAAAGGATTTGTATAACT
CATGACACCTAACAGAATAGGTTAATTCACATTGTGGAATGCCCACGCATGTGAGAGAAA
ACACTGACATTGTTGAGTTGTTTTCTTGCATCGAGATTGAGAATGTTAACTTGATCAAGA
GCCAAGTAGAATCCAATTCCTGTTATCAACAGAATCTTCGTAACTGGTATCGATGAGGTT
ATGAACGGATCCAAAAGCCTCATCCTCATCTTCGCTTTCCATCTGATACCAAAGAAACCA
AAACAATATCTTCTATAGAATAACCAGTTATGCATT
GenBank Accession CR357300 [GenBank]
Graphic View Graphic view of gene At1g20925
Predicted Position of Insertion Chr1:7291022 - go to primer design
BLAST e Value 1e-110
Hit Clone Code (BAC ID) F9H16
Hit Gene Code At1g20925 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Auxin efflux carrier family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03