SimpleSearch - Line and FST details


Line specific information

 
Line ID 720E07
Vector Used pGABI1
Line Availability only available from NASC (N469079)
Segregation Analysis 50:50:42
Confirmed for Hit At1g14685
Parent of DUPLO pair none
Parent of pair(s) 2835, 95896

Gene hit At1g14685

 
Sequence (A. th genome BLAST matches underlined)
>53-K025278-022-720-E07-8409
GGATGCGAGTCTAATGATGGGGCCTACCGGGACGTATCACCACCAAGAGCCTCCTATCCA
CGTGAGCTACAATTGGATTAACCAACAGAAGGATAAGTTCTTCAATATGTTGCCTGTTAC
AACAGCCACTCCTAACTACGGTAAGGTCCTTCCCCAAACTTCATCTGCTCCGTCGATGCA
GATGAATCTCCATCATCATCTTCAAACCGAGGAGAATCCGGTTAAGTTGGAAGAAGAGAT
TGTTGTTCAGACTAAGAAGAGAAAGACCAATGCAAAAGCTGGCTCGACTCCAAAGGCTAA
TAAGCCAAGGAAACCAAAGGATGATAACAGTATCAACTCCAACAACAACAACACGAATGT
TACTCGAGTTAAACCCGCTTATAAAAGTGTTGACTTGATGATCAAGGGAGTGAGTATGGA
GenBank Accession CR357525 [GenBank]
Graphic View Graphic view of gene At1g14685
Predicted Position of Insertion Chr1:5043139 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5E21
Hit Gene Code At1g14685 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic pentacysteine 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03