SimpleSearch - Line and FST details


Line specific information

 
Line ID 720H07
Vector Used pGABI1
Line Availability only available from NASC (N469115)
Segregation Analysis 50:50:36
Confirmed for Hit At2g22770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g22770

 
Sequence (A. th genome BLAST matches underlined)
>56-K025278-022-720-H07-8409
AGCCTTTACATTGAAATATCCTGGATTTTGGTTTTAGGAATTAAAAATTTTATTGATAGA
AGTATTTTACAAATACAAATACATACGAAGGGTTTCTTATATGCTCAACACATGAGCGAA
ACCCTATAAGAACCCTAATTCCCTTATCTGGGAACTACTCACACATTATTATAGAGAGAG
ATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGGGCATGCCTGTATGGGATCCTCCCTA
TAGTGAGAATTTCCCGATATGCGGGGAAACTAACACCAACCCCGGTTCCGAGTCTGGATC
TGGAACCGGGTTTGAGTTGCTAGCAGAAAGACCAACGAAGCAAATGAAAACCAACAACAA
CATGAATTCAACATCTTCTTCTCCGTCGTCTTCTTCTTCTTCTGGTTCTCGCACGTCACA
AGTGATCTCATTTGGGTCTCCAGACACGAAAACCAACCCGGTCGAGACATCTTTGAACTT
CTCCAACCAAGTAAGCATGGATCAGAAAGTGGGGTCGAAA
GenBank Accession CR357572 [GenBank]
Graphic View Graphic view of gene At2g22770
Predicted Position of Insertion Chr2:9684716 - go to primer design
BLAST e Value 1e-64
Hit Clone Code (BAC ID) T9I22
Hit Gene Code At2g22770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR357573 [GenBank]


Last Updated on 07.07.2016 14:03