SimpleSearch - Line and FST details


Line specific information

 
Line ID 722H09
Vector Used pGABI1
Line Availability only available from NASC (N469309)
Segregation Analysis 50:45:30
Confirmed for Hit At2g38700
Parent of DUPLO pair 1361
Parent of pair(s) none

Gene hit At2g38700

 
Sequence (A. th genome BLAST matches underlined)
>72-K025132-022-722-H09-8409
NNTTTCCGCAGTATCCGGACATGAGCCTTTACATTGAATATATCCTGCAGAAACAGGAAA
GTAGCAGTTGAATTGCTGCAGGGGCTGCTCTACTGCTTCCCTCCTAAGCCTGACACAGAC
ATGAAGAGGTGAGATAGGAATTGTTATTGATCTGATTGATTGATTTAATTCCTGACTAAT
AAAAATGGTGTTTTGGTATGGGATCCTCCCTATAGTGAGTTGGTATGGGATCCTCCCTAT
GenBank Accession CR357873 [GenBank]
Graphic View Graphic view of gene At2g38700
Predicted Position of Insertion Chr2:16181279 - go to primer design
BLAST e Value 1e-79
Hit Clone Code (BAC ID) T6A23
Hit Gene Code At2g38700 [TAIR] [MIPS] [SIGnAL]
Gene Annotation mevalonate diphosphate decarboxylase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR398413 [GenBank]


Last Updated on 14.10.2014 10:23