SimpleSearch - Line and FST details


Line specific information

 
Line ID 723E11
Vector Used pGABI1
Line Availability only available from NASC (N469371)
Segregation Analysis 50:41:37
Confirmed for Hit At2g02860
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g02860

 
Sequence (A. th genome BLAST matches underlined)
>85-K025364-022-723-E11-8409
AACGTTGACTATTAAGTTAGGTTTTAGTCGCATCCGTTAATCTACAAGTCAACGGTTCCC
AGGAAAACGAATCTTCCTTCCTTCTTCACTTCCGCGTCTTCTCTCTCAATCACCTCAAAA
AAATCTATTTCATCAAAATATTCACCCGCCCGAATTTGACTCTCCGATCATCGTCTCCGA
ATCTAGATCGACGAGATCAAAACCCTAGAAATCTAAATCGGAATGAGAAATTGATTTTGA
TACGAATTAGGGATCTGTGTGTTGAGGACGATGAGTGACTCGGTGTCGATCTCGGTTCCG
TATAGGAATTTGAGGAAGGAAATTGAACTTGACACGGTCACCAAGCATCGTCAAAACGAA
TCTGGTTCTTCGTCGTTCTCTGAATCTGCTT
GenBank Accession CR357962 [GenBank]
Graphic View Graphic view of gene At2g02860
Predicted Position of Insertion Chr2:832655 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17M13
Hit Gene Code At2g02860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sucrose transporter 2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g10710

 
Sequence (A. th genome BLAST matches underlined)
>85-K025365-022-723-E11-8409
TGATTATATTTTTCCTTCGTCTTTATATGGATCCTCCCACTCCATCATGTACCAATCAAA
TATAACGTAAGGAGAATCTTCAAAAGAATACACAGAAAAATTAAAAAAGAGGGACGGAGG
ATACCAATATGTCCTCTCCTTACGGCAAAGTCGACGAGCGTGAACATGTATGGCTCGAAG
CTCGTCTTAAGACCATAAAGAACATCGCAATCATCGCTGTATCACTAGTCATTCTTGCCG
GAATCGTGATCGGAACTGTGTTAGGAACCATGGCTCATCAGAAGTCACCAAAGACAGTGG
ATACTAATAACAACGGAGACTCAATCTCCGTTTCCGATAAAGCCGTTTGCGACGTGAGGT
TGCAAAAAGAAAAGTGCTTCTAAACCCTCGGATCAGCTCCAAACGCAAGCAGTCTCAATC
CAGAAGAGCTCTTCAGATACGCAGTCAAAATCACAATCGCCGAAGTTTCAAAAGCTATCA
ACGCTTTCT
GenBank Accession CR357963 [GenBank]
Graphic View Graphic view of gene At3g10710
Predicted Position of Insertion Chr3:3352162 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T7M13
Hit Gene Code At3g10710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation root hair specific 12
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40