SimpleSearch - Line and FST details


Line specific information

 
Line ID 724B09
Vector Used pGABI1
Line Availability only available from NASC (N469429)
Segregation Analysis 50:50:37
Confirmed for Hit At2g44840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g44840

 
Sequence (A. th genome BLAST matches underlined)
>66-K025362-022-724-B09-8409
AGCCATTTACTGGCTAAGCTGAATTTTCCGCATTTGATTGGTTCTTGTAAGTATGAGCCG
GTTAGGATTAGGCCTCGCCGTCGCTCGCCGGAACCGTCAGTCTCCGATCAGTTAACGTCG
GAGCAGAAGAGGGAAAGCCACGTGGATGACGGCGAGTCTAGTTTGGTCGTATGGGATCCT
CCCTATAGTGAG
GenBank Accession CR358043 [GenBank]
Graphic View Graphic view of gene At2g44840
Predicted Position of Insertion Chr2:18495869 - go to primer design
BLAST e Value 1e-82
Hit Clone Code (BAC ID) T13E15
Hit Gene Code At2g44840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ethylene-responsive element binding factor 13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40