SimpleSearch - Line and FST details


Line specific information

 
Line ID 724E06
Vector Used pGABI1
Line Availability only available from NASC (N469462)
Segregation Analysis 50:44:31
Confirmed for Hit At4g38960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g38960

 
Sequence (A. th genome BLAST matches underlined)
>45-K025362-022-724-E06-8409
ACTCTCGGCGCGTGGATTTGGTCGTCGTCTCTTCTGGTCTCTCAAGCTTCTCCTCCATCG
TAGAAAAAGATTTTAAAGGAGCGATTTTTATAATCTTAAATAATTTCTTCCCTTTCTTCT
TCTTCTTCTAGTTCCTTGATACCAACGCGTAATCCTAACCCTTAATCTACTTCCTCCTTA
ATTAATCAGAGGTTTCTACTTATTATTTCCACTTCTCATCTCTTTCAATCGCAATCTGAG
TTCTGGCTAAAGATTTTGTCTTGAAGGTGAGATTCATTGTTCCGAATAGAGTGAGAAAAA
GACTTATAAGATTGAAAAAGCAAGATGCGGATTTTGTGCGATGCTTGCGAGAACGCAGCC
GCAATCATCTTTTGCGCCGCCGATGAAGCTGCCCTTTGTCGCCCCTGCGATGAAAAAGTA
ACTTCTCTCCCAAAAAAGCTTCCTTTTTTTCTTTAACTCTCCTCTCTATCTATTGGTTGT
GCTCTGATGGGTTCGTCAAAGATCAAGTCTTTGTTATC
GenBank Accession CR358094 [GenBank]
Graphic View Graphic view of gene At4g38960
Predicted Position of Insertion Chr4:18161252 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F19H22
Hit Gene Code At4g38960 [TAIR] [MIPS] [SIGnAL]
Gene Annotation B-box type zinc finger family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23