SimpleSearch - Line and FST details


Line specific information

 
Line ID 727B09
Vector Used pGABI1
Line Availability only available from NASC (N469717)
Segregation Analysis 50:50:37
Confirmed for Hit At1g17530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g17530

 
Sequence (A. th genome BLAST matches underlined)
>66-K025221-022-727-B09-8409
NNTTCCGTAGTAATCCGGACATGAGCCATTTACAATTGAATATAGATGGAGGTATCAAGG
TTTATAATTTGAAGGTAGATTTTGTGACTAATTCGAATTTGACCCCTTATGTTTTATTTT
GAATAATTTAACCCAAGTTCTTTCCCGACTTTACGTTTTTTCATTTTAGACCCTATAATG
TTTGACGTTTTACATAATATAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR358428 [GenBank]
Graphic View Graphic view of gene At1g17530
Predicted Position of Insertion Chr1:6027619 - go to primer design
BLAST e Value 5e-64
Hit Clone Code (BAC ID) F1L3
Hit Gene Code At1g17530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase of inner mitochondrial membrane 23
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR358428 [GenBank]


Last Updated on 31.08.2016 09:40