SimpleSearch - Line and FST details


Line specific information

 
Line ID 727B09
Vector Used pGABI1
Line Availability only available from NASC (N469717)
Segregation Analysis 50:50:37
Confirmed for Hit At1g17530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g17530

 
Sequence (A. th genome BLAST matches underlined)
>66-K025112-022-727-B09-8409
ATTTACATTGAATAAGATGGAGGTATCAAGGTTTATAATTTGAAGGTAGATTTTGTGACT
AATTCGAATTTGACCCCTTATGTTTTATTTTGAATAATTTAACCCAAGTTCTTTCCCGAC
TTTACGTTTTTTCATTTTAGACCCTATAATGTTTGACGTTTTACATAATATGGTATGGGA
TCCTCCCTATAGTGAG
GenBank Accession BX945557 [GenBank]
Graphic View Graphic view of gene At1g17530
Predicted Position of Insertion Chr1:6027615 - go to primer design
BLAST e Value 2e-66
Hit Clone Code (BAC ID) F1L3
Hit Gene Code At1g17530 [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase of inner mitochondrial membrane 23
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23