SimpleSearch - Line and FST details


Line specific information

 
Line ID 728G04
Vector Used pGABI1
Line Availability only available from NASC (N469868)
Segregation Analysis 50:49:47
Confirmed for Hit F15O5
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15O5

 
Sequence (A. th genome BLAST matches underlined)
>31-K025113-022-728-G04-8409
CGATGAGCCATTTAATTGAATATATTAGAGTTGTCTTCCTTATTTGTCATCGACAATTCA
CACACTTCCACTCCTAGATTTGAACATGAATTATAACACAGCGCGTGATCATTGGTATGG
GATCCTCCCTATAGTGAGACGNTNTGGTCTTTTTTCTTTGTTATTTGTCACTATTCTTGT
GTTGTTATATTAGATTCTGATTTATTCTGTTGATATGTGTGTCTGAAATGTTTTTTTTTG
ACTATTTTATTCTCATTATTAGTTATTTTCTTTTATATTTTCTCCGTATTTTTTATTAAT
ATTTTTGTATTTTTCTTGCACTGTTCTGGTATCTTTATCATTCTTTTATTATCTTTTTCT
AAATTTATTTATATCTATAAATTGTTTTTTTCATTTATTTCATTGTCTTCATCATTTTAT
TTTAATTTTTTTCATTTTCTGGTGTTTATCTACTTCTATCTTAATTATATGTTCAGTTTA
AATCATCCTTTTTTATAACTATATTTCTTGTTTATCCATTTCAATTACATTTACTTTTAT
AATAATATATTCTATTTCAATTTGTATTAATATTAACATTCTTCTACTTAGTCGTTTAAT
TTCTTTTCTAATTCTA
GenBank Accession BX945650 [GenBank]
Graphic View Graphic view of sequence BX945650 of line 728G04
Predicted Position of Insertion Chr5:25998471 - go to primer design
BLAST e Value 6e-33
Hit Clone Code (BAC ID) F15O5
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences


Last Updated on 07.07.2016 14:03