SimpleSearch - Line and FST details


Line specific information

 
Line ID 729A07
Vector Used pGABI1
Line Availability only available from NASC (N469895)
Segregation Analysis 50:49:47
Confirmed for Hit At2g33670
Parent of DUPLO pair none
Parent of pair(s) 4142, 4226, 9916, 9954

Gene hit At2g33670

 
Sequence (A. th genome BLAST matches underlined)
>49-K025114-022-729-A07-8409
NNNNCCTGCTATTCGGACATGACCATTTACATTGAATATATCCTGGGACTATGTATGGGA
TCTCCTCTTTGGAGGGAAAATTATCTATTTACATTTTTCTCTTTCAAGAAGAAGCAGCCA
TGGAAGGTAAAGGAGTAACCTTTAGTTCTGTTATAGTTCCTTCTGTTCAAGAGATGGTGA
AGGAGAAGGTGATCACAACGGTATGGGATCCTCCCTATAGTGAGAAAATAATCAAATTTT
CTGACAGATCTCAGCATTTGACGAAAGAAACACATCTACAAAACAGAGTAACAAGGAAAG
TCTCTCTTGCTTTAGATACATAGAAACAAGAGATGGAATAATAAAAACAAACGATCAAAA
TCTTACAACGTAGAATGAGAATCTATTTTTGGCCCAAGGATTGACATGCTCTCTAACAAA
TGATGTCTCATGTGTGAGCCTAAACCTTGAAGGGTCTGTAAATTACACCAAAGTAATAAG
AAATTGATATTCTTGTTTGAAATGTGAATGGCATCTGTAACTATAAGCTCAATAATCTAA
CCATTCATCATTTCATGATCATTTA
GenBank Accession BX945664 [GenBank]
Graphic View Graphic view of gene At2g33670
Predicted Position of Insertion Chr2:14246542 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4P9
Hit Gene Code At2g33670 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Seven transmembrane MLO family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23