SimpleSearch - Line and FST details


Line specific information

 
Line ID 734C01
Vector Used pGABI1
Line Availability only available from NASC (N470393)
Segregation Analysis 50:50:35
Confirmed for Hit At3g45645
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g45645

 
Sequence (A. th genome BLAST matches underlined)
>03-K025441-022-734-C01-8409
CCTGGATTTTGATTTTAGGAGTTATATATTTTATTGATAGAAGTATTTTAGACTATCCCT
ACTTACTATTGGTTTCCTTACATGCTCTTCATCTGAGCGAATACCCGATAAAAACCCTAT
TTGCCTTATCCGGGAACTACTCCCCCCTGATGACTCAGAGAGATATATTTGTACAGAGAG
ACTGGTGATTACTCCGTACTTGCCACCACGGAATCCCCCCTGAATCGAGACTTTGATCAA
TTGAGAGAGAAATGAACACCGGCGGTGGCCAATACACGGATTTTCCGGCGGTGGAAACTC
ACGGAGGACAGTTCATAAGTTACGATATCTTCGGTAGTTTATTCGAGATCACATCTAAGT
ATCGTCCTCCGATTATACCAATTGGTCGTGGAGCTTATGGAATCGTTTGGTATGTTTCCT
TCTCTGAGCTTTTTCTTAAGTTTTATTCTTTGAGATCGGAGTTTTTAATTTCTGGATTTT
GATTTTGTG
GenBank Accession CR359187 [GenBank]
Graphic View Graphic view of gene At3g45645
Predicted Position of Insertion Chr3:16756684 - go to primer design
BLAST e Value 1e-110
Hit Clone Code (BAC ID) F9K21
Hit Gene Code At3g45645 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences


Last Updated on 31.08.2016 09:40