SimpleSearch - Line and FST details


Line specific information

 
Line ID 734D04
Vector Used pGABI1
Line Availability only available from NASC (N470408)
Segregation Analysis 50:48:45
Confirmed for Hit At1g75850
Parent of DUPLO pair none
Parent of pair(s) 2965, 2976

Gene hit At1g75850

 
Sequence (A. th genome BLAST matches underlined)
>28-K025441-022-734-D04-8409
GNAGCCATTTACATTGAATATATCCTGTTGTTTTGACCACCTGTAATATATAACGGTGAA
GATTCTAATGCATAACCGCTCCATTTAAATATCATATTACTATGTTTTAATTGAAAAGGT
TATAAATAATTACCAGAGCTCTTCGGCGACAACGACAGAGTCTGCTAATCTACGCCGCGT
ATGGGATCCTCCCTATAGTGAGTAGATGAATACAGCTAGATTGGCAGTGGGAGACTGGCG
ATTTCATCGGGCATGCCCGTATGGAATCCTCCCTAGATTGAGATGAACTCGGAGAGTAAA
AGTCAAAAGAGAGACTAACAGAGTCATAGCTCCGACAATAGGCATCTCAAGCTGTGTATC
TATCACCTGTAGCCCACACCAAGTCCATAAGTCAAATATATGTATTTCAAGAAAATTATT
GCATTATATGCAGGATGCTGGGAAAGCAAGTACTCTAAGAATTGAGGCTATTGTCGAACA
GAATCTACAGTATGAACTAAGGTGGTTGGATC
GenBank Accession CR359211 [GenBank]
Graphic View Graphic view of gene At1g75850
Predicted Position of Insertion Chr1:28480807 - go to primer design
BLAST e Value 8e-109
Hit Clone Code (BAC ID) T4O12
Hit Gene Code At1g75850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation VPS35 homolog B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g21880

 
Sequence (A. th genome BLAST matches underlined)
>28-K025422-022-734-D04-8409
TGACATAAAACATCTCTTGCCTTAAATATCTTCATGACATTGTAATGAAGTTCTGCACAT
TGGTATGGAATCCTCCCTATAGTGAGACCAATACATCCAAACCCTTTTCTAACACCCTCT
CCCTTAACTCGAAACCCACACACAATCCTAATTCCCATATCTAGAATCTACTCACACAGA
CATTATAAATTCAACATAGATTTCCAGAAAGAGACCCTCCCATATTCTCAGGCATGCCTG
TATGGGATCCTCCCTATAGTGAG
GenBank Accession FR815131 [GenBank]
Graphic View Graphic view of gene At4g21880
Predicted Position of Insertion Chr4:11610365 - go to primer design
BLAST e Value 9e-10
Hit Clone Code (BAC ID) T8O5
Hit Gene Code At4g21880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03