SimpleSearch - Line and FST details


Line specific information

 
Line ID 741C04
Vector Used pGABI1
Line Availability only available from NASC (N471068)
Segregation Analysis 50:50:40
Confirmed for Hit At1g77920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77920

 
Sequence (A. th genome BLAST matches underlined)
>27-K023901-022-741-C04-8409
AGCATTTAAATTGAATAATCCTGCCATAAACAAATGCATAAACAATACATCAAAACAAAG
CTAATTATGTTTTCTTTTTTATACATGCATAATAGAAAATGGTGGTTTTTGTGATATTGA
TTGATATTCTTTTGTCATATGCCAATAGATGAATCGGCGTTTAGCGCAGAACCGAGAACC
GGCTCGCAAAAGTCGTTTGAGAAAGAAGGTACAAGCAAGTCCCTTTATTGAATCTCATAT
ACTTCAGTTAGTTGCTACTACGTCCTCTTTTTTTTTGTATCTTTAGGCTTATGTCCACCT
TTCCAAGCAAAGGGGTTTATAGTA
GenBank Accession BX895387 [GenBank]
Graphic View Graphic view of gene At1g77920
Predicted Position of Insertion Chr1:29299323 - go to primer design
BLAST e Value 2e-106
Hit Clone Code (BAC ID) F28K19
Hit Gene Code At1g77920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation bZIP transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40