SimpleSearch - Line and FST details


Line specific information

 
Line ID 741D02
Vector Used pGABI1
Line Availability only available from NASC (N471078)
Segregation Analysis 50:48:31
Confirmed for Hit At3g55080
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g50240

 
Sequence (A. th genome BLAST matches underlined)
>12-K023901-022-741-D02-8409
AGCCATTTACATTGAATAAAATTTACTCTAAATTTACACGGATATTTTATTTTATTTGTG
TTAATAAGAATAAGTCAATTCTTATTTAATCCACTGGTCCGTGTGTATTGAAACAAGATC
GGATTTATTATTATACAGATCTGTCTACCACACTTTTATTATTCATATAAAATACAGTAA
TGTTGTTGGTTTTATAGACGAGTTAAATTAATTATGGTGCGTGTAAATGAGACAACTGGG
TGTGTAAAGGTCGATAATTCCAAAGTTTTGGTAGTTTCCATCGTCTCTTTAAGTTAACGA
CAAAAATTATTAAATTACGAAGAGTCAAGACATTCGTTTCTGGTCCTTCTTCTGCGCGGG
AAAATCCCAACAGTAAAATACAGATACAGAAATTATATTAAAAACAAAAATCCCAAAGTG
TAGGGACCGCAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX895397 [GenBank]
Graphic View Graphic view of gene At3g50240
Predicted Position of Insertion Chr3:18628979 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11C1
Hit Gene Code At3g50240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP binding microtubule motor family protein
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At3g55080

 
Sequence (A. th genome BLAST matches underlined)
>12-K023865-022-741-D02-8409
ATTGAATAACAACACAATGATCCCATTGAAGAACAACACAATGCATAAAACCTCCCTTAT
GAGAGATTGTATGGGATCCTCCCTATAGTGAGA
GenBank Accession BX895396 [GenBank]
Graphic View Graphic view of gene At3g55080
Predicted Position of Insertion Chr3:20413371 - go to primer design
BLAST e Value 1e-15
Hit Clone Code (BAC ID) T15C9
Hit Gene Code At3g55080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SET domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40