SimpleSearch - Line and FST details


Line specific information

 
Line ID 746H05
Vector Used pAC161
Line Availability only available from NASC (N471609)
Segregation Analysis 45:45:45
Confirmed for Hit At1g54270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g54270

 
Sequence (A. th genome BLAST matches underlined)
>40-K023904-022-746-H05-8409
ATGAAGCCTTTACAATTGAATATATCCTCCAGAGCAGAAAGTGGCGGTTTTTCCAGTACC
AGACTGTGCCTGCTGGATCACATCAAGACCCTTGCAAAAGGGTACAATTCCTCTTTGCTG
AATAGCAGAAGGCTTTTCGAAACCTATGGGATCCTCCCTATAGTGAGACNTATTNNNC
GenBank Accession BX895778 [GenBank]
Graphic View Graphic view of gene At1g54270
Predicted Position of Insertion Chr1:20260976 - go to primer design
BLAST e Value 2e-60
Hit Clone Code (BAC ID) F20D21
Hit Gene Code At1g54270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation eif4a-2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23