SimpleSearch - Line and FST details
Line specific information
| Line ID | 748G02 |
| Vector Used | pGABI1 |
| Line Availability | available as T3 set from NASC (N471786) |
| Segregation Analysis | 50:33:27 |
| Confirmed for Hit | At3g53810 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 6266, 6279, 6287, 6317, 6331, 7798, 10606, 87751, 87770, 87790, 87867, 87898, 87913, 87924, 87938, 87953, 87967, 87981, 87983, 87984, 87985, 87986 |
Gene hit At3g53810
| Sequence (A. th genome BLAST matches underlined) | >15-K023556-022-748-G02-8409 TTTACAATTGAAGGTTGTGGAGAAGGATGATACGTTGCCGTTTTGGGAATCTTTGAACCG GATTCGTTCAGTATGGGATCCTCCCTATAGTGAGA |
| GenBank Accession | BX895872 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr3:19934920 - go to primer design |
| BLAST e Value | 3e-28 |
| Hit Clone Code (BAC ID) | F5K20 |
| Hit Gene Code | At3g53810 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Concanavalin A-like lectin protein kinase family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on 10.06.2021 13:37 |




gabi-kat.de 
