SimpleSearch - Line and FST details


Line specific information

 
Line ID 750A03
Vector Used pAC161
Line Availability only available from NASC (N471907)
Segregation Analysis 50:43:27
Confirmed for Hit At3g14050
Parent of DUPLO pair 2395
Parent of pair(s) none

Gene hit At3g14050

 
Sequence (A. th genome BLAST matches underlined)
>17-K024968-022-750-A03-8409
GACATGAGCCTTTACAATTGAATATATCCTATACATATTTCTTTTTCTTTTTCTTTTGGT
CGGATGGGGAAGCTGATGGCTCCTCATGTTGTTAACTATGGGATCCTCCCTATAGTGAGT
GCTATTAATCATGGGATTGTGCGTCATTCCTTACTTCAGGGGAGATATCGCATCGGTCCA
CTTGCTTTGAAGACGTGGTTGGAAAGACTTCTTTTTCCATGATGCTCCTCGTGGGTGGTG
CTCCATCTTTGCTACTAATGGCGACATAAGCACATTGAACGTTTGCTTGGCCTGAAATTA
CGAGGAGGAAGAGGGAAAAGATGAACATTCTTTTACAGTATATATACGGTATACCAGAGA
AATGGGAATACCAATTATATCCTCCAGATTGATTAGGGAAATTTTGCCTTACTCAGACAT
TCCAATATGTACATTGTGAGAGATTGAGACAGCAGTTGTGTGGAATGCCGTAAAGGGATG
CTTGTCCCTAA
GenBank Accession BX946068 [GenBank]
Graphic View Graphic view of gene At3g14050
Predicted Position of Insertion Chr3:4650937 - go to primer design
BLAST e Value 2e-07
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g14050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RELA/SPOT homolog 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX946068 [GenBank]


Last Updated on 31.08.2016 09:40