SimpleSearch - Line and FST details


Line specific information

 
Line ID 750E08
Vector Used pAC161
Line Availability only available from NASC (N471960)
Segregation Analysis 50:37:30
Confirmed for Hit At1g01050
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g01050

 
Sequence (A. th genome BLAST matches underlined)
>61-K024970-022-750-E08-8409
AGCCATTTACATTGAATATATCCTGCAACAAAATACCCAGAAGATTAAACATGGAAAAGC
ATCAAACTTTGATGATCTTAGAACGATGACAAAAGAAAAAAAAACGTACCTTTGGATCGA
AACGAAACAGCCGATTGTTGTTTTCTTTATCGCAAGGATGATGAAGAAACTTTGGGAGAG
AAACAAGTGAAGCCCGTTGGCCTATGGGATCCTCCCTATAGTGAGACTAATTACTCCCGG
CATTGATGAAAATTGGTAAATTTACGAGATTAGAGGAAAAAGGAGAGAGAGACAAGAGCA
GCGGCGAAAAGTTACGAGGAGTAACACATACGGAGCGACATCATGTGCAAACAGAAAGGG
CAAGTGCACAAGAAAGGACGGAGATGGACAAGAAGATAAAGAGGAATAGAAGGATGAAGA
GenBank Accession BX946142 [GenBank]
Graphic View Graphic view of gene At1g01050
Predicted Position of Insertion Chr1:32944 - go to primer design
BLAST e Value 6e-79
Hit Clone Code (BAC ID) T25K16
Hit Gene Code At1g01050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation pyrophosphorylase 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX946142 [GenBank]


Last Updated on 31.08.2016 09:40