SimpleSearch - Line and FST details


Line specific information

 
Line ID 751B12
Vector Used pAC161
Line Availability available as T3 set from NASC (N472024)
Segregation Analysis 50:50:38
Confirmed for Hit At1g72650
Parent of DUPLO pair none
Parent of pair(s) 2517

Gene hit At1g72650

 
Sequence (A. th genome BLAST matches underlined) 
>90-K023564-022-751-B12-8409
ATGAAAGATGCTCCATCGAGTACTGATCCTGTGAAAGCACTTTCCTCCTCTGGCAACCAC
TATTACACTATCCTATCCTCCCTATAGTGAGACCNAATAGGCCNGAGATTATTCGAAAAT
ATACTCTCATATACAAAATTACTGATTGTTTGACCTACTAATTCAGTGTAGCCCATTATA
CGAAA
GenBank Accession FR815313 [GenBank]
Graphic View Graphic view of gene At1g72650
Predicted Position of Insertion Chr1:27351771 - go to primer design
BLAST e Value 1e-08
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRF-like 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR815313 [GenBank]


Last Updated on 10.06.2021 13:37