SimpleSearch - Line and FST details


Line specific information

 
Line ID 751B12
Vector Used pAC161
Line Availability only available from NASC (N472024)
Segregation Analysis 50:50:38
Confirmed for Hit At1g72650
Parent of DUPLO pair none
Parent of pair(s) 2517

Gene hit At1g72650

 
Sequence (A. th genome BLAST matches underlined)
>90-K023549-022-751-B12-8409
GTTGGAAATCCAGAGAAGTCCCCCCATGTGACCAATGCCATTAGAAAGGAGATGGGAGAT
GACCTAACAGCTACTAGAATGAAAGATGCTCCATCGAGTACTGATCATGTGAATGCACAT
TCAAACGGTGGCAACCACTATTACGCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
ATGGGTCTGAGATTAAACGGAAACTCACAGTCGAACCCACAATACGGAAGGTTTGCAATA
CAATTTCTTATTAGCCAATAAAAGTGCCAACACAACATTCCCGACAAATGCACACGGACC
AAGGAACCCAACATCAA
GenBank Accession BX895923 [GenBank]
Graphic View Graphic view of gene At1g72650
Predicted Position of Insertion Chr1:27351766 - go to primer design
BLAST e Value 3e-56
Hit Clone Code (BAC ID) F28P22
Hit Gene Code At1g72650 [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRF-like 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23