SimpleSearch - Line and FST details


Line specific information

 
Line ID 752F08
Vector Used pAC161
Line Availability only available from NASC (N472164)
Segregation Analysis 50:50:47
Confirmed for Hit At3g56400
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g40020

 
Sequence (A. th genome BLAST matches underlined)
>62-K023800-022-752-F08-8409
CATTTACTCATCAAAATTTCGTTGTAATTCAAATTACTTTATATGATTCTAACTAATCTT
GTGTATTAAACAATATCTTAATCTTCTTTCAAGTCATAAAGATATTAACATTGGGATAAA
AAAAAAAAAACCCTCCCCTTTAAAATCAAGAAAACCCCATATATTGCAAAAAAAAGGTAT
TATTAAAATTACAATTACCGGTTTCACAAGCTTGTTTCAAGTTTGAAGTGAAGCCCCACC
CGGTTCTATGGAACCCCCCCTATAGGGAGACNAATAAACCCCCGATGCCTTCGAAATTTG
CGTCCGCCAGAAAAAAGCCACCATCGGCAATGGTATCTTCACCGAAATAAATTTTTGAGG
AAACACAAAATAAAAA
GenBank Accession BX896095 [GenBank]
Graphic View Graphic view of gene At5g40020
Predicted Position of Insertion Chr5:16023739 - go to primer design
BLAST e Value 3e-53
Hit Clone Code (BAC ID) MYH19
Hit Gene Code At5g40020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pathogenesis-related thaumatin superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g56400

 
Sequence (A. th genome BLAST matches underlined)
>62-K023799-022-752-F08-8409
AATTGAAGCCCAGGGTGCAAGGCATCAAAGCAAGTCCAGAAGGTTGAGCTCGAACCCGCC
ATGTTCCCTATCACATATATACGAAAACCCCCGTGATAGCACCAACGCAGAGACTCCCAA
GAGCAAGACTTGTGACCATCATGATGAGATCTTCATGGATTCCGAAGATCACAAGAGTCC
TATGGGATCCTCCCTATAGTGAGACTTAGTGCTCACCAATCTCCTTTTGTCCGTATTTCC
TCCAAGAAAATGCGTCCTCAAGTATAGTCGACTCTATAGTACACGTCTCCGATCTCTTTC
TGCTCATAATATTAATGACATCAATTAATCCTTTGGCTACTTATGATTCTTGCACCCAAA
GCTACATGTCTTGTTTGTCCGGGCCCTAACCGTCAGAATTCCTGTGTACTCCTATGCAGA
CCCCCCTCACACCAGAGGCCACGACGACAGANGCGCGTCGAAGGGAACTTCCTCATACGA
GTGGTCTGAGATTACGCCAATATATACACTCATATGCCTAAATACTGACAGTTTGAGCCT
AACAATTCAGTGTACC
GenBank Accession BX896094 [GenBank]
Graphic View Graphic view of gene At3g56400
Predicted Position of Insertion Chr3:20909563 - go to primer design
BLAST e Value 3e-74
Hit Clone Code (BAC ID) T5P19
Hit Gene Code At3g56400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 70
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40