SimpleSearch - Line and FST details


Line specific information

 
Line ID 756G05
Vector Used pAC161
Line Availability only available from NASC (N472557)
Segregation Analysis 50:50:32
Confirmed for Hit At1g63650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g63650

 
Sequence (A. th genome BLAST matches underlined)
>39-K023796-022-756-G05-8409
CCATTTACATTGAATATATACATAGAAGACATACATAGATAGAAATGCGAAAGCACAACG
GAAATAAGTTTTTACTTCATTTGCATAATTGCATTATACATTTGCTATTCAAAGAAAGTA
GTAGAAAACTTTTGTTCCCATTAAGATAAAGATTTTGAGATACAAAACATAAAGGGTATT
TCCGTCTTTCTAATGTAGAATCCCCGGAGGAGCGTTATCCAATGGAGAACCAATATGGCT
TTGTAACGCTGAAACCGCCGATAGCAAAGTCTTCACTCGTTCTCTTCTATGTGAAGTAAG
TTTTTTGCAATTGAAAACGTCAACACTATGGACAACTCTCAATACTACGAACAAATACCA
ACACATTAAATTCACTAGCT
GenBank Accession BX896493 [GenBank]
Graphic View Graphic view of gene At1g63650
Predicted Position of Insertion Chr1:23600761 - go to primer design
BLAST e Value 1e-157
Hit Clone Code (BAC ID) F24D7
Hit Gene Code At1g63650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40