SimpleSearch - Line and FST details


Line specific information

 
Line ID 758C07
Vector Used pAC161
Line Availability only available from NASC (N472703)
Segregation Analysis 50:18:16
Confirmed for Hit At3g57130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g57130

 
Sequence (A. th genome BLAST matches underlined)
>51-K023907-022-758-C07-8409
ATTGAATATATCCTGACACACAATTTAATTAGATATTGAATATGTTTATCTTAATTAAAG
GATGATGGTTATCCAAAAAGGATGATAGGGACTACCAAAAGACCTATGGGATCCTCCCTA
TAGTGAGTCCTATTACTCCCTTTTTTATTCCTATTTTTTTTCCCTTTAACCTGTCTTTTT
CTCCCTCTTGGGCAGGGAATGCAATTTCCTTTTCATTAAACTTCCCCTTGCAATCCCCCC
TTTTTTTTGGGGATATCCCTGGACCCATTTTTTTTTTTCCGGGAGGCTTTGTTTTCTCCT
TTCTCCATGGTCGTGGGTTTGCGGAGGGGTGATGTAGGGTTCTACGAAAAGACCGCTGGT
TTCCCCCCTAATCAGGAGACTCTGGGTTCCTCCCTATAGTGAGACGTATTTATCCGCCCA
TTTATCCTCCCCATCCCTAACTACTGACTTTTGGTTCCCTCCGTTGTACGCGTGGGCTTG
CGCTGCGGTTGTTCTTGCTG
GenBank Accession BX896622 [GenBank]
Graphic View Graphic view of gene At3g57130
Predicted Position of Insertion Chr3:21150111 - go to primer design
BLAST e Value 3e-37
Hit Clone Code (BAC ID) F24I3
Hit Gene Code At3g57130 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ankyrin repeat family protein / BTB/POZ domain-containing protein
Insertion Classification 3' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23